Learn More About This
Directory
This directory sponsored by SIQL, a Spider Makers company...
13. Bill Owen Limited Edition Print:"Flanking Calves" - Bill Owen
- www.gallerydirectart.com
- You are here: Home > Framed Art > Western > Western Art Limited Edition Prints > Bill Owen > Bill Owen Limited Edition Print:"Flanking Calves".
- Bill Owen Limited Edition Print:"Flanking Calves".
- Title:Flanking Calves .
- You are here: Home > Framed Art > Western > Western Art Limited Edition Prints > Bill Owen > Bill Owen Limited Edition Print:"Flanking Calves".
- Bill Owen Handsigned & Numbered Limited Edition Print:"Chuck Shephard and the 4K Mares " | Bill Owen Handsigned & Numbered Limited Edition Print:"Day Herding" | Bill Owen Handsigned & Numbered Limited Edition Print:" First Day of the Fall Works" | Bill Owen Handsigned & Numbered Limited Edition Print:"Jingling Horses" | Bill Owen Handsigned & Numbered Limited Edition Print:"Moving Camp at Windmill" | Bill Owen Handsigned & Numbered Limited Edition Print:"Moving the Remuda" | Bill Owen Handsigned & Numbered Limited Edition Print:" Noon Change on the Big Outfit " | Bill Owen Limited Edition Print: "Foghorn" | Bill Owen Limited Edition Print: "Tailin' Her Down" | Bill Owen Limited Edition Print:"Teamwork at the Bluestem Ranch" | Bill Owen Limited Edition Print:"Flanking Calves" | Bill Owen Limited Edition Print:"Leadin' in a Maverick" | Cowboy Art by Bill Owen Limited Edition Print:"Getting High" | Bill Owen Limited Edition Print:"Muddy Waters" | Bill Owen Limited Edition Print:"Desert Cow Camp" | Bill Owen Limited Edition Print:"Moving The Remuda" | Bill Owen Limited Edition Print:"Watering Hole at Redlands" | Bill Owen Limited Edition Print:"A Li'l Encouragement" | Bill Owen Hand Signed and Numbered Limited Edition Print "Mustangs of the Santa Maria " | Bill Owen Handsigned & Numbered Limited Edition Print:"An E3 Ranch Horse".
14. Flanking marker - Glossary Entry - Genetics Home Reference
- ghr.nlm.nih.gov
- Glossary A | B | C | D | E | F | G | H | I | J-K | L | M | N | O | P | Q-R | S | T | U | V | W-X | Y-Z Flanking marker.
- , flanking), as opposed to an intragenic marker which is located within the gene itself. Flanking markers are used in linkage analysis to track the coinheritance of the gene in question. ...
15. A complex satellite DNA polymorphism flanking RYR1
- www.biozentrum.uni-wuerzburg.de
- flanking the ryanodine receptor gene (RYR1).
- We describe a new highly polymorphic DNA-marker flanking the ryanodine receptor gene (RYR1 ) on chromosome 19q13. ... Together with D19S422, the new polymorphism makes a pair of markers closely flanking the RYR1 gene on either side which may be useful for linkage studies in Malignant Hyperthermia and Central Core Disease families. ...
- We have characterized a new highly polymorphic DNA marker in the 5' flanking region of the RYR1 gene, which consists of a 25-bp minisatellite sequence, a compound perfect dinucleotide repeat (AC)(AT) and an oligo-T-run at the 3' end of an Alu-J-element: (GTACATACCTGTACATACATATATA)n TGTATATACCT GTACATGAACAG (AC)x(AT)y(T)z (Genbank acc. ... 9 and AFMa123xe9 two microsatellite markers are available directly flanking the RYR1 gene on either sides. ...
16. Qtl (Ensj-core API)
- www.ensembl.org
- A Qtl is defined by two or three markers, two flanking and one optional peak marker. ...
- One flanking marker of the interest region, the two flanking markers define the region.
- One flanking marker of the interest region, the two flanking markers define the region.
- One flanking marker of the interest region, the two flanking markers define the region.
- One flanking marker of the interest region, the two flanking markers define the region.
- public Marker getFlankMarker1() One flanking marker of the interest region, the two flanking markers define the region. ...
- Returns:first flanking marker or null if undefined. ...
- public Marker getFlankMarker2() One flanking marker of the interest region, the two flanking markers define the region. ...
- Returns:second flanking marker or null if undefined. ...
- public void setFlankMarker1(Marker marker) One flanking marker of the interest region, the two flanking markers define the region. ...
- Parameters:marker - first flanking marker. ...
- public void setFlankMarker2(Marker marker) One flanking marker of the interest region, the two flanking markers define the region. ...
- Parameters:marker - second flanking marker. ...
17. Journal of Vision - Disparity capture by flanking stimuli: A measure for the cooperative mechanism of stereopsis, by Petrov & Li
- journalofvision.org
- Disparity capture by flanking stimuli: A measure for the cooperative mechanism of stereopsis Yury Petrov.
- In this work we measure the range and scaling properties of the cooperative interaction by studying the effect that flanking Gabor patches produce on a perception of a target pair of patches. The relative depth configuration of the target pair can switch from the small disparity gradient to a large disparity gradient state (originally a "false" match) as a result of contextual effects of the flanking stimuli. ...
- Disparity capture by flanking stimuli: A measure for the cooperative mechanism of stereopsis Abstract . ...
18. CHARACTERIZATION OF MICROSATELLITE FLANKING SEQUENCES IN VITIS SPECIES
- www.actahort.org
- ISHS Acta Horticulturae 546: International Symposium on Molecular Markers for Characterizing Genotypes and Identifying Cultivars in Horticulture CHARACTERIZATION OF MICROSATELLITE FLANKING SEQUENCES IN VITIS SPECIES.
- The SSR unique flanking sequences were used in several eukaryotic taxa for transferring microsatellites isolated from a source species to a related species. ... This work provides new insights into (1) the transportability of microsatellites isolated from Vitis vinifera to different Vitis species and (2) the possibility of using microsatellite flanking sequences for taxonomic and phylogenetic inference. ... Point mutations have been found in microsatellite flanking regions and these variations have been used to investigate the genetic relationship among taxa. ...
19. ANALYSIS OF CONTEXT FEATURES OF DNA SEQUENCES FLANKING TRANSCRIPTION SIGNALS
- wwwmgs.bionet.nsc.ru
- However, a large amount of contextual features of long flanking sequences around functional sites is important for functional site recognition 4 .
- We introduce a method for revealing of correlated nucleotide positions in long DNA sequences flanking functional sites. The method was applied for analysis of CRE flanking regions in genes of vertebrates. ...
- Analysis of the CRE flanking regions was carried out by the entropy correlation coefficient. ...
20. Three Columns - Flanking Menus
- www.bluerobot.com
- Flanking Menus.
- In fact, this "flanking menus" technique was devised by BlueRobot for that site. ...
21. Alignment of Spec 5'-flanking DNA
- urchin.spbcas.ru
- Alignment of Spec 5'-flanking DNA.
22. Flanking Genes in the Prion Gene Neighborhood
- www.mad-cow.org
- flanking direct repeats 15 bp.
- flanking direct repeats 15 bp .
- Similar diagnostic residues are found in flanking UTR that allocate ESTs not reaching coding regions. ...
- What is the bottom line here? On the one hand, the chromosome 20 ferritin has all the properties of a classical pseudogene derived recently from the liver ferritin mRNA from chr 19: it is processed (intronless) and retropositioned (direct flanking repeats, genomic poly A). ...
- The 5' flanking region of the rat L-gene contains sequences homologous to those in the flanking areas of the human L- and H-genes. ...
- While direct flanking repeats are not evident, a translation gives both an internal frameshift and a stop codon though 86% identity after frame-jumping. ...
23. Debian Bug report logs - #241235 - ITP: primer3 -- Biology Tool design flanking oligo nucleotides for DNA amplification
- bugs.debian.org
- ITP: primer3 -- Biology Tool design flanking oligo nucleotides for DNA amplification.
- org Subject: Re: Bug#241235: ITP: primer3 -- Biology Tool design flanking oligo nucleotides for DNA amplification Message-ID: <20040331144113. ...
24. DNA sequence of the 5' flanking region of the human interleukin 2 gene: homologies with adult T-cell leukemia virus.
- www.aegis.com
- DNA sequence of the 5' flanking region of the human interleukin 2 gene: homologies with adult T-cell leukemia virus. ...
- of the 5' flanking region. ... before the start site of transcription and have compared the entire sequence of the IL-2 gene and its 5' flanking region with that of Adult T-cell leukemia virus (ATLV). ... Three areas of homology to the viral long terminal repeat (LTR) were seen in the 5' sequence flanking IL-2. ...
Other related topics:
Do you have a great site about Flanking? Is
your Flanking site listed here?
Would you like a prefered placement of your site in this directory?
It's easy! First place, the HTML from the box below on your page that
you would like listed in this directory.
Then use our link submission request with
your name, your contact information, and the URL of your site that has
a link to this directory. After we
verify your link to us, we'll make sure your site stays in our directory,
and we'll give it prefered placement here also.
Here is how to make a simple text link to us. Just copy the code in this
box to your website:
We can also develop a custom Guide To The Internet for your site. Please
request your own
custom Guide To The Internet.
This custom Guide To The Internet produced by
Siql. Visit us today, and find out how to get your own
custom guide to the Internet, and how to get your site
listed in our guides.
Copyright 1995-2005 by Siql. All
Rights Reserved.